136 research outputs found
Variational Principle for Nonequilibrium Steady States Tested by Molecular Dynamics Simulation of Model Liquid Crystal Systems
The purpose of the work presented in this chapter is to test a recently proven variational principle according to which the irreversible energy dissipation rate is minimal in the linear regime of a nonequilibrium steady state. This test is carried out by performing molecular dynamics simulations of liquid crystals subject to velocity gradients and temperature gradients. Since the energy dissipation rate varies with the orientation of the director of the liquid crystal relative to these gradients and is minimal at certain orientations, this is a stringent test of the variational principle. More particularly, a nematic liquid crystal model based on the Gay-Berne potential, which can be regarded as a Lennard-Jones fluid generalized to elliptical molecular cores, is studied under planar Couette flow, planar elongational flow, and under a temperature gradient. It is found that the director of a nematic liquid crystal consisting of rod-like molecules lies in the vorticity plane at an angle of about 20° to the stream lines in the planar Couette flow. In the elongational flow, it is parallel to the elongation direction, and it is perpendicular to the temperature gradient in a heat flow. These orientations are the ones where the irreversible energy dissipation rate is minimal, so that the variational principle is fulfilled in these three cases
Pattern preferences of DNA nucleotide motifs by polyamines putrescine2+, spermidine3+ and spermine4
The interactions of natural polyamines (putrescine2+, spermidine3+ and spermine4+) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove - in its narrowest part. The preferable localization of putrescine2+, spermidine3+ and spermine4+ in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments
Non-Uniform FFT and Its Applications in Particle Simulations
Ewald summation method, based on Non-Uniform FFTs (ENUF) to compute the electrostatic interactions and forces, is implemented in two different particle simulation schemes to model molecular and soft matter, in classical all-atom Molecular Dynamics and in Dissipative Particle Dynamics for coarse-grained particles. The method combines the traditional Ewald method with a non-uniform fast Fourier transform library (NFFT), making it highly efficient. It scales linearly with the number of particles as , while being both robust and accurate. It conserves both energy and the momentum to float point accuracy. As demonstrated here, it is straight- forward to implement the method in existing computer simulation codes to treat the electrostatic interactions either between point-charges or charge distributions. It should be an attractive alternative to mesh-based Ewald methods
Molecular dynamics simulation study of parallel telomeric DNA quadruplexes at different ionic strengths: evaluation of water and ion models
Most molecular dynamics (MD) simulations of DNA quadruplexes have been performed under minimal salt conditions using the Åqvist potential parameters for the cation with the TIP3P water model. Recently, this combination of parameters has been reported to be problematic for the stability of quadruplex DNA, especially caused by the ion interactions inside or near the quadruplex channel. Here, we verify how the choice of ion parameters and water model can affect the quadruplex structural stability and the interactions with the ions outside the channel. We have performed a series of MD simulations of the human full-parallel telomeric quadruplex by neutralizing its negative charge with K+ ions. Three combinations of different cation potential parameters and water models have been used: (a) Åqvist ion parameters, TIP3P water model; (b) Joung and Cheatham ion parameters, TIP3P water model; and (c) Joung and Cheatham ion parameters, TIP4Pew water model. For the combinations (b) and (c), the effect of the ionic strength has been evaluated by adding increasing amounts of KCl salt (50, 100, and 200 mM). Two independent simulations using the Åqvist parameters with the TIP3P model show that this combination is clearly less suited for the studied quadruplex with K+ as counterions. In both simulations, one ion escapes from the channel, followed by significant deformation of the structure, leading to deviating conformation compared to that in the reference crystallographic data. For the other combinations of ion and water potentials, no tendency is observed for the channel ions to escape from the quadruplex channel. In addition, the internal mobility of the three loops, torsion angles, and counterion affinity have been investigated at varied salt concentrations. In summary, the selection of ion and water models is crucial as it can affect both the structure and dynamics as well as the interactions of the quadruplex with its counterions. The results obtained with the TIP4Pew model are found to be closest to the experimental data at all of the studied ion concentrations
- …